anova followed by fisher’s test graphpad prism software version 9.3 Search Results


93
Gatan Inc digitalmicrograph software
Digitalmicrograph Software, supplied by Gatan Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anova+followed+by+fisher%E2%80%99s+test+graphpad+prism+software+version+9%2E3/DigitalMicrograph+Software/custom%40700%2Els%2E700%2E00%2E64%2E1%4035876458
Average 93 stars, based on 1 article reviews
digitalmicrograph software - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

95
Bio X Cell be0248 biological samples leukopack new york blood center chemicals
Be0248 Biological Samples Leukopack New York Blood Center Chemicals, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anova+followed+by+fisher%E2%80%99s+test+graphpad+prism+software+version+9%2E3/InVivoMAb+anti-human+CD28/pm33878536-39-22-21
Average 95 stars, based on 1 article reviews
be0248 biological samples leukopack new york blood center chemicals - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

99
Thermo Fisher assay agarose beads pierce protein a g plus thermo fisher
Assay Agarose Beads Pierce Protein A G Plus Thermo Fisher, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anova+followed+by+fisher%E2%80%99s+test+graphpad+prism+software+version+9%2E3/Agarose/10__7554_slash_elife__37813-230-115-122
Average 99 stars, based on 1 article reviews
assay agarose beads pierce protein a g plus thermo fisher - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Tree Star Inc ttggtccagccaccagcttg tsingke biotech n a recombinant dna pmx ires tdtomato
Ttggtccagccaccagcttg Tsingke Biotech N A Recombinant Dna Pmx Ires Tdtomato, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anova+followed+by+fisher%E2%80%99s+test+graphpad+prism+software+version+9%2E3/7+a+a+dna+dna+dna+exon+integrated+integrated+n+n+recombinant+software+ssdna+technologies+technologies+tnfrsf14/pm41557504-236-1-22
Average 86 stars, based on 1 article reviews
ttggtccagccaccagcttg tsingke biotech n a recombinant dna pmx ires tdtomato - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

93
R&D Systems antibody mouse hj 9 3
Antibody Mouse Hj 9 3, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anova+followed+by+fisher%E2%80%99s+test+graphpad+prism+software+version+9%2E3/Rat+Anti-Mouse+IgG2A+PE-conjugated+Antibody/10__7554_slash_elife__37813-230-33-40
Average 93 stars, based on 1 article reviews
antibody mouse hj 9 3 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

86
Tree Star Inc flowjo v10 treestar
Flowjo V10 Treestar, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anova+followed+by+fisher%E2%80%99s+test+graphpad+prism+software+version+9%2E3/algorithms+flowjo+star+tree+v10/10__1016_slash_j__isci__2025__112800-274-28-30
Average 86 stars, based on 1 article reviews
flowjo v10 treestar - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Ora Flow Inc periotron 8000
Periotron 8000, supplied by Ora Flow Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anova+followed+by+fisher%E2%80%99s+test+graphpad+prism+software+version+9%2E3/pmc05654654-389-75-80
Average 86 stars, based on 1 article reviews
periotron 8000 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

92
Addgene inc pf 5xuas mcs sv40 puro
Pf 5xuas Mcs Sv40 Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anova+followed+by+fisher%E2%80%99s+test+graphpad+prism+software+version+9%2E3/pHCA%2FGAL4(1-93)%2EER%2EVP16+(Plasmid+%23108216)/pm38039134-218-12-19
Average 92 stars, based on 1 article reviews
pf 5xuas mcs sv40 puro - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
Becton Dickinson mueller-hinton (mh) broth
Mueller Hinton (Mh) Broth, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anova+followed+by+fisher%E2%80%99s+test+graphpad+prism+software+version+9%2E3/mueller+hinton+agar/pm38759643-243-29-34
Average 90 stars, based on 1 article reviews
mueller-hinton (mh) broth - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
BioShop l(+)-arabinose
L(+) Arabinose, supplied by BioShop, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anova+followed+by+fisher%E2%80%99s+test+graphpad+prism+software+version+9%2E3/l+arabinose/10__7554_slash_elife__64207-266-56-58
Average 90 stars, based on 1 article reviews
l(+)-arabinose - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
BioShop d-fructose
D Fructose, supplied by BioShop, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anova+followed+by+fisher%E2%80%99s+test+graphpad+prism+software+version+9%2E3/d+fructose/10__7554_slash_elife__64207-266-27-29
Average 90 stars, based on 1 article reviews
d-fructose - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
Jackson Laboratory organisms
Organisms, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anova+followed+by+fisher%E2%80%99s+test+graphpad+prism+software+version+9%2E3/organisms+strains/pm41037397-178-8-16
Average 86 stars, based on 1 article reviews
organisms - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results